 |
 |
|
|
| Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
| Circ-104916 | |||
| Gene | NEK6 | Organism | Human |
| Genome Locus | n/a | Build | hg19 |
| Disease | Gastric Cancer | ICD-10 | Stomach, Malignant neoplasm of unspecified (C16.9) |
| DBLink | Link to database | PMID | 28761361 |
| Experimental Method | |||
| Sample Type | Tissues and AGS, MKN-28, NCI-N87,MKN-45 and GES-1 Cell lines | Comparison | 70 pairs of human GC specimens and their adjacent noncancerous tissue samples |
| Method for Estimation | qPCR, Western blot, In vitro cell migration and invasion assay etc. | PCR Details | |
| Primers (Experimented) | Forward GCTCGGTGACCTTGGTCTGG ReverseGCGTGTTGGGATGCCTCTGT | Statistics | Fold Change : Downregulated pvalue : p<0.05 |
| Citation | |||
| Li, J, Zhen, L, Zhang, Y, Zhao, L, Liu, H, Cai, D, Chen, H, Yu, J, Qi, X, Li, G (2017). Circ-104916 is downregulated in gastric cancer and suppresses migration and invasion of gastric cancer cells. Onco Targets Ther, 10:3521-3529. | |||